of 6

Chlamydophila psittaci and Toxoplasma gondii infection in pigeons (Columba livia) from São Paulo State, Brazil

2 views
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Share
Description
Pigeons (Columba livia) cohabit with humans in urban and rural areas, representing a public health problem since microorganisms are transmitted through the inhalation of dust from their dry feces (chlamydiosis) and through ingestion of their
Transcript
  Veterinary Parasitology 175 (2011) 9–14 Contents lists available at ScienceDirect VeterinaryParasitology  journal homepage: www.elsevier.com/locate/vetpar Chlamydophila psittaci  and  Toxoplasma gondii  infection in pigeons( Columba livia ) from São Paulo State, Brazil Vanessa Yuri de Lima a , b , c , ∗ , Helio Langoni b , Aristeu Vieira da Silva d ,Sandia Bergamaschi Pezerico b , André Peres Barbosa de Castro b ,Rodrigo Costa da Silva b , João Pessoa Araújo Jr. c a School of Veterinary Medicine, Pontifical Catholic University, Toledo, Paraná State, Brazil b School of Veterinary Medicine and Animal Science, São Paulo State University, Botucatu, São Paulo State, Brazil c Institute of Biosciences, São Paulo State University, Botucatu, São Paulo State, Brazil d Department of Biological Sciences, The State University of Feira de Santana, Feira de Santana, Bahia State, Brazil a r t i c l e i n f o  Article history: Received 22 October 2009Received in revised form 4 October 2010Accepted 6 October 2010 Keywords:Columba liviaChlamydophila psittaciToxoplasma gondii ZoonosisInfection sourceDiagnosis a b s t r a c t Pigeons( Columbalivia )cohabitwithhumansinurbanandruralareas,representingapublichealth problem since microorganisms are transmitted through the inhalation of dust fromtheirdryfeces(chlamydiosis)andthroughingestionoftheirundercookedorpoorlyrefrig-erated meat (toxoplasmosis). This study aimed to evaluate the presence of   Chlamydophila psittaci and Toxoplasmagondii inpigeonsfromfourcitiesinSãoPauloState,Brazil. C.psittaci was evaluated through hemi-nested polymerase chain reaction (hnPCR) using cloacal andtracheal swabs, whereas  T. gondii  specific antibodies were assessed by means of modifiedagglutinationtest(MAT),mousebrainandmusclebioassay,andpolymerasechainreaction(PCR). To confirm the infection in mice,  T. gondii  antibodies were assayed by using indirectfluorescent antibody test (IFAT). Considering  C. psittaci , 40/238 (16.8%; 95%CI 12.6–22.1%)sampleswerepositiveaccordingtohnPCR,especiallyforthecitiesofSãoPaulo(42.5%)andBauru(35%).Asregards T.gondii ,12/238(5%;95%CI2.9–8.6%)serumsampleswerepositiveaccording to MAT. Of these, five samples had titer equal to 1:8; six samples, 1:16; and onesample, 1:32. Bioassay, IFAT and PCR were negative for mouse toxoplasmosis. The absenceof   T. gondii  antibodies suggests that pigeons may be infected with a low concentration of the agent, not detected by the antigen test. Thus,  C. psittaci  represents an actual problemconcerning bird health. © 2010 Elsevier B.V. All rights reserved. 1. Introduction Pigeons ( Columba livia ) cohabit with humans in urbanandruralareasandarecapableofadaptingtoandsurvivingin the city, which results in large populations and con- ∗ Corresponding author at: Departamento de Higiene Veterinária eSaúde Pública, Faculdade de Medicina Veterinária e Zootecnia, Universi-dadeEstadualPaulista,DistritodeRubiãoJr.,s/n.,Botucatu,SP18618-000,Brazil. Tel.: +55 14 38116270; fax: +55 14 38116075. E-mail address:  vanessa.yuri@pucpr.br (V.Y. de Lima). sequently serious public health problems. Accumulationof their feces in shelters and procreation sites gener-ates dirt and damage to constructions and monuments(Haag-Wackernagel,2003).Primaryproblemsincludepub- lic health due to diseases transmitted through inhalationof their dry feces or contact with their moist feces, feetand feathers in case of histoplasmosis, cryptococcosis andchlamydiosis. Transmission also occurs through ingestionofpoorlyrefrigeratedandrawmeatincaseoftoxoplasmo-sis and salmonellosis (São Paulo, 2003). Chlamydophila psittaci  is an obligate intracellular par-asite which causes chlamydiosis (Everett et al., 1999), an 0304-4017/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2010.10.006  10  V.Y. de Lima et al. / Veterinary Parasitology 175 (2011) 9–14 infectious disease that globally affects humans, as wellas domestic and wild birds, its main reservoirs (Grimes,1996;CarpenterandGentz,1997;Kirchner,1997).Pigeonsare frequently infected by  C. psittaci  and can eliminateinfectious forms named elementary bodies (EBs) either insecretions from their cloaca, upper and lower respiratorytractandeyes(Calneketal.,1997),orinaerosoloriginated fromsuchsecretions.Transmissionoccursthroughinhala-tion or ingestion of   C. psittaci  (Illner, 1962; Lehnert, 1962;Wilt et al., 1972; Wittenbrink et al., 1993; Lublin et al.,1996).Toxoplasmosis is caused by an Apicomplexan para-site,  Toxoplasma gondii , and represents another importantzoonosis reaching one-third of the human populationworldwide (Dubey and Beattie, 1988; Martins and Viana,1998). Warm-blooded animals are affected by ingestingcontaminated feline feces and raw or undercooked meat,as well as transplacentally (Tenter and Johnson, 1997).This parasite can be detected in most organs of birds(Dubey et al., 2008; Oliveira et al., 2009) such as pigeons, as demonstrated by Dubey (2002). The risk to humans is high and directly related to customs and hygiene habitssince the infection occurs by accidental ingestion of theparasite.Thus, the present study aimed to determine the impor-tance of pigeons as precursors of these two importantzoonoses. 2. Materials and methods  2.1. Experimental design This study was designed as observational, transver-sal and descriptive, employing high-sensitivity methodsto detect  C. psittaci  and  T. gondii  among pigeon popula-tionsfromdifferenthabitats.Serologyandmousebioassaywere carried out in the labs of the Zoonosis Research Cen-ter, Department of Veterinary Hygiene and Public Health(DHVSP), School of Veterinary Medicine and Animal Sci-ence(FMVZ),SãoPauloStateUniversity(UNESP),BotucatuCampus,SãoPauloState,Brazil.Themoleculardetectionof microorganisms was carried out in the labs of the Instituteof Biosciences, located in the same university.This experiment was approved by the Animal Experi-mentation Ethics Committee of FMVZ.  2.2. Animals and strains Pigeons ( Columba livia ) were captured from differentsites for the epidemiological study based on  T. gondii  and C. psittaci  detection.Female30-day-oldSwissalbinomice,fromCentralAni-mal Facility of UNESP-Botucatu were used to producehome-made antigens for serological tests and bioassay of pigeon samples. T. gondii  RH strain, genotype I, was kept by weeklyinoculation into Swiss albino mice and was used for theserological test and molecular technique as  T. gondii  posi-tivecontrol.TheantigenDadeBehring(Germain)wasusedas  C. psittaci  positive control.  2.3. Sample size and studied area Two hundred and thirty-eight pigeons were capturedfromfourcitiesinSãoPauloState,Brazil:Bauru(22 ◦ 18 ′ 53S;49 ◦ 03 ′ 38W), 51; São Paulo (23 ◦ 32 ′ 51S; 46 ◦ 38 ′ 10W), 45;Sorocaba (23 ◦ 30 ′ 06S; 47 ◦ 27 ′ 29W), 44; and Botucatu(22 ◦ 53 ′ 09S; 48 ◦ 26 ′ 42W), 98. In Bauru, São Paulo and Soro-caba, the birds were captured from zoo areas, whereas inBotucatutheywerecapturedfrompublicsquaresandfromlarge and small farms (Table 1). Pigeons were captured by usinghome-madetrapsdisposedinplaceswheretheircon-centration was high.The birds were manually restrained and euthanized byusingthelethaldoseof2%pentobarbitalsolutionaftersam-ple collection, which requires live animals. Blood sampleswere collected and serum samples kept at  − 20 ◦ C untilserological tests.A total of 476 cloacal and tracheal swab samples wereassayed for  C. psittaci  identification. These samples werevortexed and kept in ethyl alcohol for up to 30 days. For T. gondii , chest muscle and brain samples were collected,refrigeratedandprocessedupto48h;spleensampleswerekept at  − 80 ◦ C until molecular detection.  2.4. Chlamydophila psittaci test  ForDNAextractionfromcloacalandtrachealswabs,thetubes were centrifuged at 20,000 ×  g   for 30min at 4 ◦ C;then, ethyl alcohol was removed and the pellet dilutedinto 40  L buffer (0.1M NaCl, 10mM Tris–HCl pH 8.0,1mM EDTA, 5% triton X-100) and 15  L proteinase K(20mgmL  − 1 ). After digestion at 56 ◦ C for 90min and pro-teinase K inactivation for 5min at 70 ◦ C, samples werecentrifuged (2000 ×  g  ) for 20min at 22 ◦ C and the cloacaland tracheal supernatants from the same animals weremixed, totaling 238 samples. DNA was extracted by usingGFX TM Genomic Blood DNA Purification Kit (AmershamBioscience, USA) following the manufacturer’s instruc-tions.Hemi-nested (hn) PCR was done according to Buxtonet al. (1996) directed to  C. psittaci  major outer membraneprotein (MOMP) gene, M36703.1 [GenBank]; 5  L cDNApoolforPCRand1  LofthePCRproductforthehnPCRwereaddedtoareactionbuffer(50mMKCl,75mMTris–HCl(pH9.0), with 0.2mM MgCl 2 , 20mM (NH4) 2 SO 4 ), plus 0.1mMdNTPs, 0.1mM of each dNTP, 0.1  M of each primer:cla420 107–129 (5 ′ CAGGACATCTTGTCTGGCTTTAA3 ′ )and cla422 349–366 (5 ′ GCAAGGATCGCAAGGATC3 ′ ) forPCR, amplifying a 260bp product, and cla421 202–225(5 ′ TTAGAGGTGAGTATGAAAAAACTC3 ′ ) and cla422 forhnPCR, amplifying a 165bp product; 1U  Tth  DNA Poly-merase (Biotools, Spain) and autoclaved ultrapure waterto a final volume of 25  L. The cycles in thermal cyclerincluded denaturation at 94 ◦ C for 10min followed by 35cycles of denaturation for 60s at 94 ◦ C; primer annealingfor 60s at 54 ◦ C for PCR and 52 ◦ C for hnPCR; extensionat 72 ◦ C for 90s; and a final step of primer extension at72 ◦ C for 4min. The reaction product was kept at 4 ◦ C.The reaction mixture (10  L) was subjected to agarosegel electrophoresis with Tris–bromide EDTA buffer and0.5  gmL  − 1 ethidium bromide. The final products were  V.Y. de Lima et al. / Veterinary Parasitology 175 (2011) 9–14 11  Table 1 Description of habitats where pigeons were captured per city.City Area Place Number of capturedanimalsZoo/non-zoo Habitat epidemiological characteristicsBotucatuUrban areaPublic square a 6 Non-zoo Presence of a church, bus stop station and public high schoolin front of the church.Traffic of many people all day long, some of them eating corngrains, crushed grains, popcorn and bread commercialized inthis area.Residential area b 21 Non-zoo Houses with a strip of land and sand ground behind thehouses with chicken breed. These places were dirt andaccumulated garbage.In front of one commercial residence (pet food store), a greatamount of pigeons were captured. Pigeons were observedeating dog and cat food from this store.Rural area University building 35 Non-zoo Animals were captured near breeding animalUniversity farm 36 Non-zoo Nests of pigeons were observed in the lining of farms. Theselinings were very dirt.Bauru Urban area Municipal zoo c 51 Zoo All zoos presented similar epidemiological conditions.Pigeons were captured in iron grating enclosures locatedfar from healthy animals. These places were empty, but ina normal day, they were used for quarantine or isolation totreat zoo animals.São Paulo Urban area Municipal zoo c 45 ZooSorocaba Urban area Municipal zoo c 44 Zoo a Public square located in the commercial center of Botucatu. b Residential houses with high amount of pigeons per day. c São Paulo’s zoo is larger than Bauru’s, which is bigger than Sorocaba’s. According to the size, the zoos present large or small numbers of people andpigeons, the latter looking for food, resulting in popcorn and pigeon’s feces on the soil. observed in UV light gel analyzer and compared to 50bpDNA Ladder (Amersham Bioscience, USA). Samples wereconsidered positive when a final 165bp product wasobtained in hnPCR.  2.5. Toxoplasma gondii tests 2.5.1. Serology of pigeons All pigeon serum samples were assayed throughmodified agglutination test (MAT) with formalin-fixedtachyzoites, homely produced in female 30 day-old Swissmice inoculated with the  T. gondii  RH strain and Sar-coma TG-180 cells (ATCC CCRFS-180 II), as described byDesmonts and Remington (1980). Serum samples wereinitially tested in 1:2 and 1:4 dilutions, and samplesthat showed titers equal to 1:8 were further diluted induplicates, until the final titer. Positive and negative con-trols were also used. Samples presenting titers equalor superior to 1:8 were considered positive. No repli-cates were done. This was used as a screening test forPCR.  2.5.2. Mouse bioassay Bioassay procedures were based on those described byDubey (1998), including 211 muscle and brain samples.Twenty-seven animals did not have sufficient tissue for alltests. One millilitre of digested brain and muscle samplesfrom each rat, with pepsin solution, were independentlybioassayed in groups of five albino Swiss mice by subcuta-neousroute;theywereobservedforupto30days.Animalsthat died during the observation period were researchedfor the presence of tachyzoites in the peritoneal fluid ortissue cysts in the brain. After 30 days p.i., mice wereeuthanizedinanisofluoranevapor-saturatedchamberandblood samples were obtained through orbital sinus punc-ture followed by centrifugation. The serum samples wereassayed through indirect fluorescent antibody test (IFAT)for IgG antibodies, using a home-made antigen producedin female Swiss mice inoculated with  T. gondii  RH strainand mouse IgG (h&l) antibody chicken FITC conjugated,A90-217F (Bethyl Laboratories, USA). Serum samples werescreened in 1:16 dilution. Positive and negative controlswere also used (Camargo, 1964).  2.5.3. Polymerase chain reaction (PCR) Twelve spleen samples from positive animals andtwelve samples from negative animals were used for PCR.DNA was extracted from fragments sized about 1/3 of the whole spleen, according to the protocol described bySambrook and Russel (2001).PCR was performed by using the primers describedby Homan et al. (2000), which amplify a 529bp fragment, AF146527 [GenBank], repeated 200–300times in  T. gondii  genome. Thus, primers TOX4(5 ′ CGCTGCAGGGAGGAAGACGAAAGTTG3 ′ ) and TOX5(5 ′ CGCTGCAGACACAGTGCATCTGGATT3 ′ ) were used. PCR was performed in a 25  L reaction mixture containing10  M of each primer (Invitrogen, Brazil), 10 ×  PCR buffer(50mM KCl, 10mM Tris–HCl, Invitrogen, Brazil), 1.5mMMgCl 2  (Invitrogen, Brazil), 1.25mM dNTP (Invitrogen,Brazil), 0.15U Platinum  Taq  polymerase (Invitrogen,Brazil), and ultrapure water q.s. Amplification was per-formed in a MJ Research Thermal Cycler (MJ Research Inc.,USA). Initial denaturation for 7min at 94 ◦ C was followedby 35 cycles of 1min at 94 ◦ C, 1min at 60 ◦ C and 1minat 72 ◦ C, and a final extension for 10min at 72 ◦ C. Thesequence was visualized through electrophoresis in 2%agarose gel and stained with ethidium bromide. Cross-reaction was not reported using TOX4 and TOX5 primersduring  T. gondii  PCR, according to Homan et al. (2000).  12  V.Y. de Lima et al. / Veterinary Parasitology 175 (2011) 9–14  Table 2 Frequency of   Chlamydophilla psittaci  detected through hnPCR per city.City Positive/total City percentage; 95%CI Total frequency; 95%CIBauru 14/51 27.4; 17.1–41.0 35.0; 22.1–50.6Botucatu 6/98 6.1; 2.9–12.7 15.0; 7.2–29.2Sorocaba 3/44 6.8; 2.5–18.3 7.5; 2.7–19.9São Paulo 17/45 37.8; 25.1–52.4 42.5; 28.5–57.9Total 40/238 16.8; 12.6–22.1 100.0; -95%CI: confidence interval 95%.  2.6. Statistical analysisC. psittaci  positive results were compared among thestudiedcitiesbyusingChi-Squaretestwith95%confidenceinterval and  ˛ =0.05 (Triola, 1999). 3. Results As shown in Table 2, 40/238 (16.8%; 95%CI 12.6–22.1%) samples were positive for  C. psittaci  according to hnPCR:14/51 (27.4%; 95%CI 17.1–41.0%) in Bauru, 17/45 (37.8%;95%CI 25.1–52.4%) in São Paulo, 3/44 (6.8%; 95%CI2.5–18.3%) in Sorocaba, and 6/98 (6.1%; 95%CI 2.9–12.7%)in Botucatu.Considering T.gondii ,12/238(5%;95%CI2.9–8.6%)sam-pleswerepositiveaccordingtoMAT:fivehadtiterequalto1:8;six,1:16;andone,1:32.All211pigeonswerenegativeaccordingtomousebioassayandIFAT,whileall24sampleswere negative according to PCR. 4. Discussion Thedistinctfrequenciesofpigeonspositivefor C.psittaci in São Paulo State, Brazil, corroborate previous findingsaround the world (Grelloni et al., 1997; Andersen et al.,1997; Cislakova et al., 1998; Travnicek and Misko, 2000;Mushi et al., 2001; Travnicek et al., 2002).In previous studies carried out in our laboratory, sepa-ratetrachealandcloacalswabextractionshadnodifference(data not shown) since all animals with positive trachealswab samples also had positive cloacal swabs, accordingto hnPCR. Based on such results, separate extraction wasnotadoptedtoavoidcompromisingtheresults.hnPCRwaschosen,ratherthanserology,duetoitshighsensitivityandspecificityforDNAsequencedetection.hnPCRisarapidandeasy-to-performdiagnostictestbecauseitdoesnotrequiretheliveagent(OIE,2000)andiscapableofdetectingtenEBs (DahlhausenandRadabaugh,1997),demonstratingitshigh sensitivity.Olsenetal.(1998)usedPCRtotestfecalsamples andfound9/312(2.89%)positivebirdsinSweden.McElneaandCross(1999)alsousedPCRasoneofthemethodsfor C. psittaci  detection in domestic and wild birds and observed16% positive samples among captured birds with no clin-ical signs of illness, similarly to the present study (16.8%).These findings assure the importance of birds, especiallypigeons, as  C. psittaci -carriers in Brazil.Most diagnostic tests present problems concerningantibody and antigen detection, leading to false-positiveand false-negative results (Dahlhausen and Radabaugh,1997).Mushietal.(2001)reported7/16(43.8%) C. psittaci -positive pigeon samples by using complement fixation.Evenwithhighpositivepercentage,smallsamplesmustbeconsideredinthetestassessmentandadoptionofepidemi-ological measures. However, the detection of antibodiescan reflect their ability to contaminate the environment.Thefrequenciesofpositiveresultsfor C.psittaci obtainedin São Paulo, 17/45 (37.7%), and in Bauru, 14/51 (27.4%),werestatisticallydifferentfromthosedetectedinBotucatu,6/98 (6.1%), and Sorocaba, 3/44 (6.8%). São Paulo (42.5%)andBauru(35%)accountedfor77.5%ofthepositiveresults(Table2),sincethesearebigcitiespresentingalargenum- ber of free pigeons. The different frequencies among thestudied cities could be attributed to other birds or wildhosts especially from the rural area of Botucatu, differ-ent habitats in different studied areas, or cohabitation inzooareas.Inaddition,thehighfrequenciesfoundforthesecitiesaremostlyrelatedtothecohabitationofpigeonswithother hosts that can be sources of infection. The zoo in SãoPaulo is larger than that of Bauru and other cities, present-ing higher circulation of people per day, food on the soil,and consequently attracting pigeons. On the other hand,pigeons from Sorocaba (also from a zoo area) did not havehigh positive percentage probably due to the animal careprogram,thecleaning,andtherestrictiveaccessofpigeonsin the zoo.ThescenarioobservedinthezoosofBauruandSãoPaulois of public health concern. A high visitation rate in theseplaces increases the risk of exposure of visitors to infectedanimals or pigeons, which play an important role as infec-tion transmitters to zoo animals. Since pigeons have freeaccesstotheseplaces,theycancontaminateexoticanimalsof inestimable value, causing their death. Therefore, a highamount of pigeon feces accumulates and exposes otherhosts to  C. psittaci  infection, mainly in zoos. Thus, urbanpigeons are more susceptive than rural ones, as observedinareasfromBotucatu,whichwastheonlycitywherebirdswere not captured from zoos. In this city, the frequency of positivesampleswaslow,exceptincommercialplaceslikein front of pet food store and public churches. However,these results are also of concern since the microorganismwas found and contamination and dissemination are pos-sible due to the proximity to other birds.The presence of   C. psittaci  in the samples of this studyconfirms the pigeon potential to carry and transmit theagent. As a result, the agent is kept in the environmentand can be transmitted to other susceptible animals andhumans.Asregards T.gondii ,5%serumsampleswerepositive,allfromBotucatu.Thisprevalencewassimilartothatobtainedby Waap et al. (2008) (4.8%) in Lisbon, Portugal and higher than that observed by Godoi et al. (2008) in Sorocaba, Brazil. All samples were negative for antigen diagnosis, as  V.Y. de Lima et al. / Veterinary Parasitology 175 (2011) 9–14 13 reported by Godoi et al. (2008) using bioassay; however,the obtained percentages were lower than those obtainedby Waap et al. (2008) (12/23; 52.17%) using PCR. Despitethelackofepidemiologicalknowledgeconcern-ing this agent in the studied bird species and the smallnumberofstudiesinBrazil,theroleofpigeonsaspotentialcarriersofthismicroorganismtohumansisknowninothercountries. Its diagnosis is based on clinical signs and sero-logical tests, besides the presence of the agent in tissuesor body fluids (Dubey and Frenkel, 1998). Since pigeons usually present more subclinical infections, the associa-tion between clinical signs and positive serology or theagentdetectioniscompromised(DubeyandBeattie,1988),requiring tests of high sensitivity such as PCR and biolog-ical tests for diagnosis. Mouse inoculation is very specificand sensitive for parasite isolation (Wong and Remington,1994); however, the prolonged time to confirm resultsis certainly an important disadvantage. IFAT should notbe considered the ultimate diagnosis since  T. gondii  hasalready been isolated from seronegative mice (Dubey andFrenkel, 1998). Mouse inoculation is still considered thegold-standardmethodduetoitshighsensitivityandspeci-ficity (Homan et al., 2000). However, in Botswana, Mushi et al. (2001) obtained 16/16 (100%) positive results for  T. gondii  diagnosis using MAT. This result should be carefullyanalyzed since  T. gondii  cannot be diagnosed only throughserological tests, as previously described.Marca et al. (1996) compared IFAT and MAT and con-cluded that they are indicated for toxoplasmosis diagnosissincebothtestshadsimilarresults,presentinghighimpor-tance for diagnosis and epidemiological tests (Desmontsand Remington, 1980; Dubey et al., 1997).The use of molecular diagnostic techniques is par-ticularly appropriate for patients presenting subclinicalinfections since these techniques do not depend on thehost immunological status. However, since the immuneresponse plays a very important role in the developmentof toxoplasmosis, several studies have emphasized thehypothesis that the outcome and the clinical presentationare also related to the virulence of specific  T. gondii  geno-types (Sibley and Boothroyd, 1992; Boothroyd and Grigg,2002; Dubey et al., 2008).All24samplestestedthroughPCRwerenegative.Theseresults show the reduced risk of infection in the studiedarea due to the food provided to pigeons, differently fromthe risk reported by Waap et al. (2008). In zoo areas, free pigeons eat the food of captive animals. In addition, mostpeople from Botucatu feed pigeons corn grains, crushedcorn and bread; consequently, the probability of infectionis lower. The risk of transmission of these zoonoses appar-entlyincreasesduetotheproximitybetweenbirdsandthehumanpopulation,sincetheformerareimportantdissem-inating agents. An educational policy should be elaboratedin order to aware people about the importance of notfeeding and not sheltering these birds, promoting theirevasion and probably making them return to their naturalhabitat.Thus, the low prevalence of   T. gondii  antibodies in allstudied cities suggests that pigeons are not a good sourceof toxoplasmosis to humans. On the other hand,  C. psittaci represents a real problem for bird health. References Andersen, A.A., Grimes, J.E., Wyrick, P.B., 1997. Chlamydiosis (Psittacosis,ornithosis). In: Calnek, B.W., Barnes, H.J. (Eds.), Diseases of Poultry,10th ed. Iowa State University Press, Iowa, pp. 333–349.Boothroyd,C.J.,Grigg,M.E.,2002.Populationbiologyof  Toxoplasmagondii and its relevance to human infection: do different strains cause dif-ferent disease? Current Opinions in Microbiology 5, 438–442.Buxton, D., Rae, A.G., Maley, S.W., Thomson, K.M., Livingtone, M., Jones,G.E., Herring, A.J., 1996. Pathogenesis of   Chlamydia psittaci  infectionin sheep: detection of the organism in a serial study of the lymphnode. Journal of Comparative Pathology 114, 221–230.Calnek, B.W., Barnes, H.J., Beard, C.W., McDougald, L.R., Saif, Y.M., 1997.DiseasesofPoultry,11th.ed.IowaStateUniversityPress,Iowa,p.1248.Camargo, M.E., 1964. Improved technique of indirect immunofluores-cence for serological diagnosis of toxoplasmosis. Revista do Institutode Medicina Tropical de São Paulo 6, 117–118.Carpenter, J.W., Gentz, E.J., 1997. Zoonotic diseases of avian srcin. In:Altman,R.B.,Clubb,S.L.,Dorrestein,G.M.,Quesenberry,K.(Eds.),AvianMedicine and Surgery. Saunders, Philadelphia, pp. 350–363.Cislakova, L., Prokopcakova, H., Dietzova, Z., 1998. Ornithosis of munic-ipal pigeons  Columba livia  f.  domestica  gone wild in Kosice – SlovakRepublic. Veterinarni Medicina UZPI 43, 361–363.Dahlhausen, B., Radabaugh, C.S., 1997. Detection of   Chlamydia psittaci infection in pet birds using a molecular based diagnostic assay. In:Association of Avian Veterinarians Proceedings, pp. 191–198.Desmonts, G., Remington, J.S., 1980. Direct agglutination test for diag-nosis of Toxoplasma infection: method for increasing sensitivity andspecificity. Journal of Clinical Microbiology 11, 562–568.Dubey, J.P., Beattie, C.P., 1988. Toxoplasmosis of Animals and Man. CRCPress, Boca Raton, p. 220.Dubey, J.P., Andrews, C.D., Thulliez, P., Lind, P., Kwok, O.C.H., 1997. Long-term humoral antibody responses by various aerologic tests in pigsorally inoculated with oocysts of four strains of   Toxoplasma gondii .Veterinary Parasitology 68, 41–50.Dubey, J.P., 1998. Refinement of pepsin digestion method for isolation of  Toxoplasma gondii  from infected tissues. Veterinary Parasitology 74,75–77.Dubey, J.P., Frenkel, J.K., 1998. Toxoplasmosis of rats: a review, with con-siderations of their value as an animal model and their possible rolein epidemiology. Veterinary Parasitology 77, 1–32.Dubey, J.P., 2002. A review of toxoplasmosis in wild birds. VeterinaryParasitology 106, 121–153.Dubey, J.P., Velmurugan, G.V., Chockalingam, A., Pena, H.F.J., de Oliveira,L.N., Leifer, C.A., Gennari, S.M., Bahia Oliveira, L.M.G., Su, C., 2008.Genetic diversity of   Toxoplasma gondii  isolates from chickens fromBrazil. Veterinary Parasitology 157, 299–305.Everett, K.D.E., Bush, R.M., Andersen, A.A., 1999. Emended descriptionof the order Chlamydiales, proposal of Parachlamydiaceae fam. nov.and Simkaniaceae fam. nov., each containing one monotypic genus,revised taxonomy of the family Chlamydiaceae, including a newgenus and five new species, and standards for the indentificationof organisms. International Journal of Systematic Bacteriology 49,415–440.Godoi, F.S.L., Rassy, F.B., Viero, L.M., Nishi, S.M., Gennari, S.M., 2008. Toxoplasmagondii infree-rangepigeonscapturedinSorocaba,SP.Pre-liminaryresults.In:ToxoplasmaCentennialCongress,1.UENF,Búzios,Brazil, p. 105.Grelloni, V., Cagiola, M., Battistacci, L., Cenci, T., Scuota, S., Principato, M.,1997. Epidemiology of zoonotic diseases in the urban environmentdue to pigeons ( Columba livia ). Veterinaria Italiana 33, 41–45.Grimes,J.E.,1996.Detectionofchlamydialinfections.In:RosskopfJr.,W.J.,Woerpel, R.W. (Eds.), Diseases of Cage and Aviary Birds. Willians andWilkins, Malvern, pp. 827–835.Haag-Wackernagel, D., 2003. Os pombos silvestres: história, problemas esoluc¸ões. Der Ornithologische Beobachter 100, 33–57.Homan, W.L., Vercammen, M., De Braekeleer, J., Verschueren, H., 2000.Identification of a 200- to 300-fold repetitive 529bp DNA fragmentin  Toxoplasma gondii , and its use for diagnostic and quantitative PCR.International Journal for Parasitology 30, 69–75.Illner, F., 1962. Ein beitrag zur enten-ornithose und ihrer epizootioogie.Monatsh Veterinaermed 17, 141–146.Kirchner,J.T.,1997.Psittacosisiscontactwithbirdscausingyourpatient’spneumonia? Psittacosis 102, 181–194.Lehnert,C.,1962.Zurfragederuebertragungdezornithosevirusueberdasbruteibeienten.BerlinerundMunchenerTierarztlicheWochenschrift75, 151–152.Lublin, A., Shudari, G., Mechani, S., Weisman, Y., 1996. Egg transmissionof   Chlamydia psittaci  in turkeys. Veterinary Record 139, 300.
Related Search
Advertisements
Related Docs
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks