of 13

Genetic Program of Neuronal Differentiation and Growth Induced by Specific Activation of NMDA Receptors

0 views
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Share
Description
Neurochem Res (2007) 32: DOI /s ORIGINAL PAPER Genetic Program of Neuronal Differentiation and Growth Induced by Specific Activation of NMDA Receptors Cristina A. Ghiani Æ
Transcript
Neurochem Res (2007) 32: DOI /s ORIGINAL PAPER Genetic Program of Neuronal Differentiation and Growth Induced by Specific Activation of NMDA Receptors Cristina A. Ghiani Æ Luis Beltran-Parrazal Æ Daniel M. Sforza Æ Jemily S. Malvar Æ Akop Seksenyan Æ Ruth Cole Æ Desmond J. Smith Æ Andrew Charles Æ Pedro A. Ferchmin Æ Jean de Vellis Accepted: 23 October 2006 / Published online: 27 December 2006 Ó Springer Science+Business Media, LLC 2006 Abstract Glutamate and its receptors are expressed very early during development and may play important roles in neurogenesis, synapse formation and brain wiring. The levels of glutamate and activity of its receptors can be influenced by exogenous factors, leading to neurodevelopmental disorders. To investigate the role of NMDA receptors on gene regulation in a neuronal model, we used primary neuronal cultures developed from embryonic rat cerebri in serum-free medium. Using Special issue dedicated to Dr. Anthony Campagnoni. C. A. Ghiani J. S. Malvar A. Seksenyan R. Cole J. de Vellis (&) Mental Retardation Research Center, Jane and Terry Semel Institute for Neuroscience and Human Behaviour, Departments of Neurobiology and Psychiatry, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, CA 90095, USA L. Beltran-Parrazal A. Charles Department of Neurology, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, CA 90095, USA D. M. Sforza D. J. Smith Department of Molecular and Medical Pharmacology, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, CA 90024, USA P. A. Ferchmin Department of Biochemistry, Universidad Central del Caribe, Bayamón, Puerto Rico 00960, USA Present Address: D. M. Sforza Laboratory of NeuroImaging, Department of Neurology, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, CA , USA Affymetrix Gene Arrays, we found that genes known to be involved in neuronal plasticity were differentially expressed 24 h after a brief activation of NMDA receptors. The upregulation of these genes was accompanied by a sustained induction of CREB phosphorylation, and an increase in synaptophysin immunoreactivity. We conclude that NMDA receptor activation elicits expression of genes whose downstream products are involved in the regulation of early phases of the process leading to synaptogenesis and its consolidation, at least in part through sustained CREB phosphorylation. Keywords N-methyl-D-Aspartate Cortical neurons DNA array Gene regulation CREB Brain development Abbreviations NMDA N-methyl-D-aspartate AMPA a-amino-3-hydroxy-5-methylisoxazole-4- propionic acid BDNF Brain derived neurotrophic factor CREB camp responsive element binding CBP CREB binding protein IEGs Immediate early genes LTP Long term potentiation NARP Neuronal activity-regulated pentraxin NF-L Light molecular-weight neurofilament NGFI-B NGF-induced factor B NOR Neuron-derived orphan receptor pcreb Phosphorylated CREB Introduction Mammalian brain development is modulated by the orchestrated interaction of cell intrinsic and extrinsic 364 Neurochem Res (2007) 32: factors that, in turn, can be influenced by environmental stimuli. In utero exposure to harmful substances connected with maternal behaviour and/or exposure (e.g. consumption of neurotoxic substances) may induce untimely interactions between the cell intrinsic and extrinsic signalling factors, interfering with proper brain development and increasing the risk of neurodevelopmental diseases [1 4]. Among the extrinsic factors, neurotransmitters and their receptors play key roles in central nervous system (CNS) development [5]. Glutamate is the major excitatory neurotransmitter in the brain. Its receptors are expressed early in development by neural progenitors and by selected early neuronal populations. This suggests that they might play a role in directing the development of later populations, and in the proper wiring of the developing CNS [5 7]. Glutamatergic actions are mediated through 3 types of ionotropic (ligand-gated ion channels) receptors (iglur: N-methyl-D-Aspartate (NMDA), a-amino-3-hydroxy- 5-methylisoxazole-4-propionic acid (AMPA) and Kainate) and one group of G-protein coupled metabotropic receptors (mglur) of which several functional subunits have been identified [8, 9]. The expression of these receptor subtypes and their subunits appears to be developmentally regulated, as some of them are only expressed during embryonic or early postnatal life. In order to properly influence developmental events, each of these subtypes and some of their subunits need to be expressed at the right time. Changes in subunit composition drive their effects and are essential for proper brain development [10]. Among the iglur, NMDA receptor activation regulates developmental programs during embryonic and perinatal periods. These receptors directly or indirectly influence cell proliferation, migration, cytoskeleton-related protein synthesis, and the formation and establishment of synapses [5 7, 10 12]. Most importantly, it was reported that blockage of NMDA receptors during brain development triggers neuronal cell death [13], further supporting the notion that in addition to support neuronal development and the development of neuronal circuits, they are important for neuronal survival. NMDA receptor activity is highly enhanced during perinatal life to promote activity-dependent synaptic connections. Immature NMDA receptor-gated channels open easily resulting in more calcium influx than in the adult brain [4]. Therefore, any event or stimulus that interferes with this normal level of synaptic activity will disturb brain development and may lead to life-long disabilities. For example, abnormal stimulation of glutamatergic receptors or excessive levels of glutamate can lead to excitotoxicity and subsequent perinatal brain injury [4]. Thus, it is extremely important to understand which target genes are involved in NMDA actions as well as which factors may modulate NMDAmediated good or bad effects [14]. In addition, knowledge on NMDA-induced gene regulation could help developing strategies for alleviating neurodevelopmental deficiencies. In the adult brain [9, 15] NMDA receptors have been implicated in activation of signalling pathways leading to synaptic plasticity, process outgrowth and strengthening of pre-existing connections. Their activation regulates early and late phases of synaptic formation and consolidation. These cellular programs involve activation of transcription factors and immediate early genes (IEGs), up-regulation of gene expression and de novo protein synthesis [16 21]. The role of NMDA receptors on gene expression mediated by induction of IEGs and transcription factors has been extensively studied in the hippocampus [22 25], and after injury or stress [26 28] both in vivo and in vitro. However, a detailed analysis of the effects of NMDA receptor activation on regulation of gene expression in embryonic cortical neurons in the complete absence of glial cells is still lacking. Furthermore, little is known about the effects that a massive NMDA receptor activation can have on young neurons [29]. We have previously shown that massive activation of NMDA receptors in primary neuronal cultures from rat embryonic cerebral cortex elicited changes in the expression of IEGs and transcription factors such as: cfos, NGFI-B, Krox-24. These effects were accompanied by changes in cfos protein levels and sustained increase in intracellular calcium. NMDA even at the very high dose of 1 mm did not trigger apoptosis, which appeared to be mediated through AMPA receptors [30]. In the present report by using the same culture system [30] in which neuronal responses can be measured in the absence of glial cells, a cell composition resembling an immature brain, we show evidence for a link between NMDA receptor activation and gene regulation mediated, at least in part, through sustained induction of camp responsive element-binding (CREB) phosphorylation. Strong evidence of the involvement of the transcription factor CREB as mediator/effector of NMDA receptor action on gene expression are still lacking. Data presented in the literature remain controversial (for review: Platenik et al. 2000, [31]). We addressed the role of NMDA receptors in the program of cortical neuronal maturation, using our serum-free neuronal specific culture medium and gene array analysis. Our Neurochem Res (2007) 32: work shows that the use of the combination DNA microarray-real-time RT-PCR is a reliable and quantitative tool to assess gene regulation in cortical neurons in vitro. Experimental procedure Materials NMDA, creatine, poly-d-lysine were purchased from Sigma, Saint Louis, MO, USA. Human recombinant bfgf, B27 supplement and DMEM-F12 were from Invitrogen Life Technologies, Carlsbad, CA, USA. The antibody directed against phosphorylated Ser133 CREB (pcreb; rabbit polyclonal) was purchased from Upstate Biotechnology (Lake Placid, NY, USA). Anti-MAP2 (mouse monoclonal) and anti-synaptophysin (mouse monoclonal) were from Sigma (Saint Louis, MO, USA). Anti-GFAP (mouse monoclonal and rabbit polyclonal) was from Neomarkers (Fremont, CA, USA). All secondary Affinipure fluorochromeconjugated antibodies were purchased from Jackson ImmunoResearch Laboratories Inc. (West Grove, PA, USA). Primary rat neuronal cortical culture Cultures were prepared as previously described [30, 32] with minor modifications. E16 Sprague-Dawley rats (Charles-River, Wilmington, MA, USA) were killed following the National Institutes of Health and UCLA animal welfare guidelines. Cerebral cortices were removed, combined in DMEM-F12 containing 10% pure fetal calf serum (Atlanta Biologicals, Norcross, GA, USA) and mechanically dissociated for 2 min using a Stomacher 80 (Seward, London, UK). The dissociated cells were filtered in turn through 140 lm and 230 lm sieves (Cellector, E-C Apparatus Corp., Holbrook, NY, USA) to remove large clusters. Sieves were washed sequentially with DMEM-F12 containing 10% pure fetal calf serum. Cells were collected by centrifugation, and cell pellet was resuspended in a neuronal specific medium [32], TII, supplemented with bfgf (10 ng ml -1 ), B27 (1:50), and creatine (2 mg ml 1 ). The cells were plated onto freshly poly-d-lysine coated dishes and cultured for days unless differently stated. Purity of the cultures was assessed by double immunostaining with neuronal, astrocytic, oligodendrocyte and microglial markers. The cultures were 98% immunopositive for MAP2 and the remaining immunostained for astrocytic or oligodendrocyte markers. No microglial cells were detected. DNA array analysis Total RNA was extracted from primary neuronal cortical cultures grown on 100 mm dishes ( cells ml 1 ) for 11 days by using TRIzol reagent (Invitrogen, Life Technologies, Carlsbad, CA, USA), cleaned with RNeasy (Qiagen, Valencia, CA, USA), and its quality was monitored by micro-capillary electrophoresis (Bioanalizer 2100, Agilent Technologies). Hybridisation and scanning of the Genechip Rat Neurobiology U34 oligonucleotide arrays (Affymetrix Inc., Santa Clara, CA, USA) was performed at the UCLA Microarray Core Facility following protocols recommended by the manufacturer. Expression values, representative of the amount of transcripts in solution, were calculated using Robust Microarray Analysis (RMA) [33]. Hybridisation experiments were repeated either 3 or 5 times using independent RNA samples. Data represent the average of all independent hybridisations in each experimental condition. Before further analysis, we selected the genes whose expression was more than 2-fold or less than 0.5-fold when compared with the control. After this selection, a t statistic was used to determine which genes were differentially expressed. Differences in expression were considered significant when p 0.05 for Student s t test. Final list of interesting genes was obtained by filtering all genes that were significantly, differentially expressed in at least one condition. The software GENECLUSTER was used to perform the mathematical calculations and to obtain convenient data visualisation [34]. Real-Time RT-PCR Total RNA (600 ng ll 1 ) isolated as described above was reverse transcribed using the RETROscript kit from Ambion (Austin, TX, USA), and then analysed for various transcript expressions (see Table 1) by Realtime RT-PCR on an icycler iq Detection System (BioRad, Hercules, CA, USA). To design Real-time RT-PCR-grade primers, cdna encoding was first analysed for secondary structures using M-fold software [35, 36]. Portions of sequence lacking secondary structure were imported into Oligo6 software (Molecular Biology Insights) to design highly stringent primer sets (Listed in Table 1). PCR amplification resulted in the generation of single bands of sizes between 80 and 100 bp (see Table 1). To standardise the experiments we designed, using the same approach, a primer set for the rat b 2 - microglobulin gene. Amplified bands for all the genes were cloned into PCRII using the TOPO cloning kit (Invitrogen, Life Technologies, Carlsbad, CA, USA) and sequenced to confirm identity. Real-time RT-PCR 366 Neurochem Res (2007) 32: Table 1 Oligonucleotide primers used for Real-time PCR Gene (accession #) 5 primer 3 primer Amplicon Annealing temperature Length (bp) Position ( C) NR2A (NM_012573) ATACCGGCAGAACTCCACAC CAGGCATCACACTTGAAAGG NR2B (NM_012574) GCGCTACTTCAGGGACAAAG AAG TCC ACG TGC TCC CAG T BDNF (NM_012513) TAAAAAGACTGCAGTGGACA CATGGGATTACACTTGGTCT c-fos (X06769) GAGTGGTGAAGACCATGTCA TCCTCTTCAGGAGATAGCTGC NARP (S82649) TAAAGTCTGTGAGCCTCTCC CACACACGAGACACTAAGGA NOR-1 (NM_031628) AGCCTTTTTGGAGCTGTTCGT CTGAAGTCGGTGCAGGACAAG NGFI-B (U17254) GCCACCTCCAACCTTCTTCTC CTGGGAACAACTTCAGGGAAC VGF (M60525) CCCCTAAAACACATCTTGGTG GGAACCGCCCAGGAATGAGCC CBP/p300 (NM_053698) GCCCAATGTCATAGACACTGATT CCTTGATGCGGTCCAAAC Ania-3 (XM_31707) ACCAGCAAGCATGCAGTTACT ATTTATTATTGCCTTTGAGCC NF-L (NM_031783) CAGCCTGGAGAACCTCGATCT AAGCGATCGTTGAGGTCCTGC CAACTGCTACGTGTCTCAG TTTGGTATCTTCTTTCCATT b2-microglobulin (NM _012512) was set up using the iq SYBRGreen supermix (Bio-Rad, Hercules, CA, USA), for 60 cycles of a three-step procedure including a 30 s denaturation at 95 C, a 30 s annealing at temperatures between 60 and 65 C (see Table 1), followed by a 30 s extension at 72 C. Amplification specificity was assessed by melting curve analysis. Quantification utilised standard curves made from serial dilutions of control RNA sample. Differences between samples were calculated as percentage of control for the specific ratio (gene/b 2 -microglobulin) calculated for each individual sample. PCR quantification was performed in triplicate. Statistical analysis was performed using GraphPad Prism 4.01 (GraphPad Software, Inc., San Diego, CA, USA). Immunocytochemistry Neuronal cultures were plated onto glass coverslips ( cells ml 1 ) coated with Poly-D-Lysine and cultured for 11 days. The cells were fixed in 4% paraformaldehyde in PBS for 15 min; permeabilised for 10 min in 0.2% Triton X 100 and blocked in 10% normal goat serum for 15 min; all these steps were performed at room temperature. Primary antibodies were diluted in PBS + 1.5% goat serum and incubated overnight at 4 C. The coverslips were washed thoroughly in PBS and incubated for 30 min at room temperature with the secondary antibodies. After extensive washes, the coverslips were mounted in Vectashield (Vector Laboratories, Burlingame, CA, USA). Pictures were taken using an Olympus fluorescent microscope with a Zeiss digital camera or a Zeiss confocal microscope (LSM 510 Meta systems). Western blotting analysis Following NMDA (1 mm)-treatment (see Figure legends for details), 11-day-old primary neuronal cortical cultures were washed and harvested in PBS. Western Blots were performed as previously reported [37, 38]. Equal protein loading was verified by Ponceau S solution reversible staining of the blots. Relative intensities of the protein bands were quantified by scanning densitometry using the public domain NIH Image program (NIH image, ImageJ, nih.gov/ij/). Statistical analysis was performed using GraphPad Prism 4.01 (GraphPad Software, Inc., San Diego, CA, USA). Calcium imaging Fluorescence imaging was performed using a custombuilt video-rate confocal microscope, as previously Neurochem Res (2007) 32: described [30]. In brief, cells on coverslips were loaded with the Ca 2+ indicator fluo 4 by incubation in 3 lm fluo-4 AM for min. Cells were excited with a 475-nm diode laser and imaged with 20 or 40 water immersion objectives. The resulting fluorescence was bandpass filtered at 510 nm and detected by a photomultiplier tube (Hamamatsu). Excitation and emission were scanned with two oscillating mirrors (GSI Lumonics). Images were captured with a Raven board (Bit Flow, Inc.) using Video Savant software. Maximum image resolution was 980X730 at 15 frames per second. Analysis of imaging data was performed using ImageJ software. Cells were considered to have a response to NMDA if they showed either a 20% increase in fluorescence over background, or at least a 50% increase in the frequency of spontaneous Ca 2+ transients in response to bath application of NMDA. Results Primary cortical neurons express NMDA receptor subunits In the present work, we used primary cortical neuronal cultures from 16-day rat embryos. RNA extracted from primary cortical neurons at different days in culture was analysed by Real-time RT-PCR for the expression of subunits for NMDA receptors. We focus our attention on receptor subunits known to be highly represented in the cerebral cortex, and to be present since early development [8, 10]. Primary neuronal cortical cultures at 11 days in culture expressed the NMDA receptor subunit NR1 required for the formation of functional NMDA receptors (data not shown). Furthermore, since NR2A and NR2B subunit expressions are developmentally regulated and a switch in the levels of these subunits is accompanied by changes in the properties of the cationic channel coupled to NMDA receptors, we analysed the expression of these subunits by Real-time RT-PCR. Primary neuronal cultures were shown to express transcripts for both NR2A and NR2B subunits (Fig. 1A). Their levels were detectable at 24 h after plating and both subunits showed a peak at 5 days in culture. Then the expression levels of NR2A slowly decreased (Fig. 1A, upper panel), returning to levels similar to 1 day in vitro after more than 30 days in vitro (data not shown). On the other hand, NR2B expression was high between 5 and 7 days in vitro, dropping by 11 days to its level at 1 day (Fig. 1A, lower panel). Although we found some quantitative differences Fig. 1 Panel A: Cortical neurons in cultures express NMDA receptor subunits. Cortical neurons from E16 embryos were harvested in Trizol after different days in culture. The total RNA extracted was used as template for the RT-Reaction. The relative levels of expression of the genes of interest were normalised versus b 2 -microglobulin and then compared to the levels at 1 day in culture. The plots are the average ± SEM of 3 5 independent experiments performed in triplicate. Panel B: Ca 2+ response to NMDA at different days after culture. Graph shows the percentage of cells that responded to NMDA with an increase in [Ca 2+ ] i (n = 150 total cells on 3 different coverslips for each time point). Relatively few neurons showed an increase in [Ca 2+ ] i in response to NMDA at 1 day in culture, but this number increased progressively until day 10 between the levels of expression of NR2A and NR2B, they were both expressed at all the time points. Consistent with the receptor subunit expression, only a small percentage of cells responded to NMDA (10 lm) with an increase in intracellular Ca 2+ at day 1. The Ca 2+ response to NMDA increased with culture age up to 10 days, at which time it rem
Related Search
Advertisements
Related Docs
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks